Gene: Mouse Ccnb1-rs5 (545021)

This gene has been discontinued and we have no replacement information available at this time.

shRNA constructs designed to target this gene

The following shRNA constructs were originally designed to target this discontinued gene.

Target Taxon[?] Target Gene ID Target Gene Symbol Clone ID Target Seq Vector Target Transcript Match Position Match Region[?] Intrinsic Score[?] Adjusted Score[?] Addgene[?]
1 mouse 545021 Ccnb1-rs5 TRCN0000088055 TCTTGGAGACATTGGTAATAA pLKO.1 XM_283394.2 212 CDS 15.000 n/a
2 mouse 545021 Ccnb1-rs5 TRCN0000088057 GCTTCAGGAGACCATGTTTAT pLKO.1 XM_283394.2 542 CDS 13.200 n/a
3 mouse 545021 Ccnb1-rs5 TRCN0000088054 CCTGAACCTGAACTTGAACAT pLKO.1 XM_283394.2 378 CDS 4.950 n/a
4 mouse 545021 Ccnb1-rs5 TRCN0000088056 GACTGGAAACATGAGAGCTAT pLKO.1 XM_283394.2 479 CDS 4.950 n/a
5 mouse 545021 Ccnb1-rs5 TRCN0000088053 GCTATCCTCATTGACTGGCTA pLKO.1 XM_283394.2 495 CDS 2.640 n/a
Download CSV

Additional Resources:

NBCI Gene record:
Ccnb1-rs5 (545021)