Transcript: Human NM_000018.4

Homo sapiens acyl-CoA dehydrogenase very long chain (ACADVL), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
ACADVL (37)
Length:
2184
CDS:
48..2015

Additional Resources:

NCBI RefSeq record:
NM_000018.4
NBCI Gene record:
ACADVL (37)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000018.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245177 CGGTAGATCATGCCACTAATC pLKO_005 1123 CDS 100% 10.800 15.120 N ACADVL n/a
2 TRCN0000245178 TTCGCATCTTCCGGATCTTTG pLKO_005 1411 CDS 100% 10.800 15.120 N ACADVL n/a
3 TRCN0000221898 GCCACTAATCGTACCCAGTTT pLKO.1 1134 CDS 100% 4.950 6.930 N ACADVL n/a
4 TRCN0000221900 CAAGGCGGAATCTAAGTCCTT pLKO.1 245 CDS 100% 2.640 3.696 N ACADVL n/a
5 TRCN0000221896 GCAGTATGTAACTGAGTCCAT pLKO.1 1214 CDS 100% 2.640 3.696 N ACADVL n/a
6 TRCN0000245175 CAGACATCTTCACGGTCTTTG pLKO_005 814 CDS 100% 10.800 7.560 N ACADVL n/a
7 TRCN0000221897 GCAGACATCTTCACGGTCTTT pLKO.1 813 CDS 100% 4.950 3.465 N ACADVL n/a
8 TRCN0000245179 AGTTATGTGCCTTCCCTCAAG pLKO_005 2040 3UTR 100% 4.050 2.835 N ACADVL n/a
9 TRCN0000221899 GAGGTGTTCTTTGATGGAGTA pLKO.1 972 CDS 100% 4.050 2.835 N ACADVL n/a
10 TRCN0000245176 GTACCATGAGAGGCATCATTG pLKO_005 1096 CDS 100% 0.000 0.000 N ACADVL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000018.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00007 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00007 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479329 GTGTCCAAAATTAAGTGTATACCT pLX_317 20.9% 100% 100% V5 n/a
Download CSV