Transcript: Human NM_000022.4

Homo sapiens adenosine deaminase (ADA), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-19
Taxon:
Homo sapiens (human)
Gene:
ADA (100)
Length:
1496
CDS:
93..1184

Additional Resources:

NCBI RefSeq record:
NM_000022.4
NBCI Gene record:
ADA (100)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000022.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429105 AGGCTAACTACTCGCTCAACA pLKO_005 952 CDS 100% 4.950 6.930 N ADA n/a
2 TRCN0000444226 CACCTAGACGGATCCATCAAG pLKO_005 141 CDS 100% 4.950 6.930 N ADA n/a
3 TRCN0000051484 CTGAACATCAATGCGGCCAAA pLKO.1 1065 CDS 100% 4.050 5.670 N ADA n/a
4 TRCN0000051483 GCTCTATAAAGCCTATGGGAT pLKO.1 1130 CDS 100% 2.640 3.696 N ADA n/a
5 TRCN0000419517 TGAACCCTATGTGTCCATTTC pLKO_005 1307 3UTR 100% 10.800 8.640 N ADA n/a
6 TRCN0000428526 AGAAGACCATGATCTCAATAG pLKO_005 1269 3UTR 100% 10.800 7.560 N ADA n/a
7 TRCN0000051485 CATGCAGTCATTCGGCTCAAA pLKO.1 924 CDS 100% 4.950 3.465 N ADA n/a
8 TRCN0000421193 GGATCGCCTATGAGTTTGTAG pLKO_005 334 CDS 100% 4.950 3.465 N ADA n/a
9 TRCN0000051486 TGACTACTACATGCCTGCTAT pLKO.1 287 CDS 100% 4.950 3.465 N ADA n/a
10 TRCN0000412870 TGAAACCATCTTATACTATGG pLKO_005 164 CDS 100% 4.050 2.835 N ADA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000022.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00023 pDONR223 100% 99.9% 100% None 36G>A n/a
2 ccsbBroad304_00023 pLX_304 0% 99.9% 100% V5 (not translated due to prior stop codon) 36G>A n/a
3 TRCN0000481062 TCCCGAGATTACATTTCAGACAAT pLX_317 45% 99.9% 100% V5 (not translated due to prior stop codon) 36G>A n/a
Download CSV