Transcript: Human NM_000027.4

Homo sapiens aspartylglucosaminidase (AGA), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
AGA (175)
Length:
2037
CDS:
63..1103

Additional Resources:

NCBI RefSeq record:
NM_000027.4
NBCI Gene record:
AGA (175)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000027.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000046878 CCCTTTAAGAATGCAACCGAA pLKO.1 165 CDS 100% 2.640 3.696 N AGA n/a
2 TRCN0000046881 CGTCAACACTTGGCCCTTTAA pLKO.1 152 CDS 100% 13.200 10.560 N AGA n/a
3 TRCN0000291179 CGTCAACACTTGGCCCTTTAA pLKO_005 152 CDS 100% 13.200 10.560 N AGA n/a
4 TRCN0000046880 CGTGTAGGAGACTCACCAATA pLKO.1 762 CDS 100% 10.800 8.640 N AGA n/a
5 TRCN0000333364 CGTGTAGGAGACTCACCAATA pLKO_005 762 CDS 100% 10.800 8.640 N AGA n/a
6 TRCN0000296792 AGGAGATCTCAGACGAATTAA pLKO_005 368 CDS 100% 15.000 10.500 N AGA n/a
7 TRCN0000331161 CATGTCTTAGCACTGATTATT pLKO_005 1552 3UTR 100% 15.000 10.500 N AGA n/a
8 TRCN0000046882 CCAAGCTACCAAGCTGTAGAA pLKO.1 864 CDS 100% 4.950 3.465 N AGA n/a
9 TRCN0000291122 CCAAGCTACCAAGCTGTAGAA pLKO_005 864 CDS 100% 4.950 3.465 N AGA n/a
10 TRCN0000046879 CCTATCCATAAAGAAACAGAA pLKO.1 639 CDS 100% 4.950 3.465 N AGA n/a
11 TRCN0000032282 GCTACCAAGCTGTAGAATATA pLKO.1 868 CDS 100% 15.000 10.500 N Aga n/a
12 TRCN0000032280 GCCAGCCAAATTATTGGAGAA pLKO.1 550 CDS 100% 4.050 2.430 N Aga n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000027.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05790 pDONR223 100% 99.9% 99.7% None 446C>G n/a
2 ccsbBroad304_05790 pLX_304 0% 99.9% 99.7% V5 446C>G n/a
3 TRCN0000469011 ATTAGTTTCGTGTCTTGCTCTCTT pLX_317 30.8% 99.9% 99.7% V5 446C>G n/a
Download CSV