Transcript: Human NM_000066.4

Homo sapiens complement C8 beta chain (C8B), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
C8B (732)
Length:
2040
CDS:
68..1843

Additional Resources:

NCBI RefSeq record:
NM_000066.4
NBCI Gene record:
C8B (732)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000066.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426624 GATCGAGGCAAACACTATATT pLKO_005 884 CDS 100% 15.000 21.000 N C8B n/a
2 TRCN0000430320 GTTCTTGATCACAGGTATTAT pLKO_005 635 CDS 100% 15.000 21.000 N C8B n/a
3 TRCN0000057100 CCAAACGATTCTCTCATACTA pLKO.1 912 CDS 100% 5.625 7.875 N C8B n/a
4 TRCN0000057099 CCATTGATTGTGAGCTGTCTA pLKO.1 252 CDS 100% 4.950 3.960 N C8B n/a
5 TRCN0000057098 GCTCTGGAAGACGTAAGACAA pLKO.1 1737 CDS 100% 4.950 3.960 N C8B n/a
6 TRCN0000057102 CAGAGGTATTCTGAATGAAAT pLKO.1 1276 CDS 100% 13.200 9.240 N C8B n/a
7 TRCN0000057101 GAACGCAATGTCACAGAGAAA pLKO.1 788 CDS 100% 4.950 3.465 N C8B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000066.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05915 pDONR223 100% 99.9% 99.8% None 349G>A n/a
2 ccsbBroad304_05915 pLX_304 0% 99.9% 99.8% V5 349G>A n/a
3 TRCN0000481247 GATCTATTCCAGGGTGACACGGTT pLX_317 24.6% 99.9% 99.8% V5 349G>A n/a
Download CSV