Transcript: Human NM_000093.5

Homo sapiens collagen type V alpha 1 chain (COL5A1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
COL5A1 (1289)
Length:
8442
CDS:
386..5902

Additional Resources:

NCBI RefSeq record:
NM_000093.5
NBCI Gene record:
COL5A1 (1289)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000093.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000082812 TGAGACCTATTACTACGAATA pLKO.1 1195 CDS 100% 10.800 15.120 N COL5A1 n/a
2 TRCN0000082809 CGAGGGTGAGACCTATTACTA pLKO.1 1189 CDS 100% 5.625 7.875 N COL5A1 n/a
3 TRCN0000082808 CCAGATTTGGACACTATATTT pLKO.1 6261 3UTR 100% 15.000 12.000 N COL5A1 n/a
4 TRCN0000415024 CGAACCAGGATACCATCTATG pLKO_005 1692 CDS 100% 10.800 8.640 N COL5A1 n/a
5 TRCN0000082811 CCGTATGATGACCTCACCTAT pLKO.1 1436 CDS 100% 4.950 3.465 N COL5A1 n/a
6 TRCN0000082810 GCTCTATTGGATTCCCTGGAT pLKO.1 3033 CDS 100% 2.640 1.848 N COL5A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000093.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000475520 AATCCCCTTTCCAAGTACGAATCA pLX_317 4.2% 32% 32.1% V5 (many diffs) n/a
Download CSV