Transcript: Human NM_000123.3

Homo sapiens ERCC excision repair 5, endonuclease (ERCC5), mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
ERCC5 (2073)
Length:
4091
CDS:
427..3987

Additional Resources:

NCBI RefSeq record:
NM_000123.3
NBCI Gene record:
ERCC5 (2073)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000123.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358809 AGAAGATGCTAAACGTATTAA pLKO_005 3438 CDS 100% 15.000 7.500 Y ERCC5 n/a
2 TRCN0000358807 AGCAGAAGAAATGCGTATAAA pLKO_005 1671 CDS 100% 15.000 7.500 Y ERCC5 n/a
3 TRCN0000358878 TTGGGATTGGACCGGAATAAG pLKO_005 2956 CDS 100% 13.200 6.600 Y ERCC5 n/a
4 TRCN0000358806 CCGATAAGTGATGAGTCTATG pLKO_005 1885 CDS 100% 10.800 5.400 Y ERCC5 n/a
5 TRCN0000050778 CCAGCGAAATAGAAGCAGTTT pLKO.1 3518 CDS 100% 4.950 2.475 Y ERCC5 n/a
6 TRCN0000050779 CCTCCTTTACAAGAGGAAGAA pLKO.1 865 CDS 100% 4.950 2.475 Y ERCC5 n/a
7 TRCN0000050780 GCTTTCAGATTCTAAACGAAA pLKO.1 3648 CDS 100% 4.950 2.475 Y ERCC5 n/a
8 TRCN0000050782 CCAATGGAAATTGACTCGGAA pLKO.1 2344 CDS 100% 2.640 1.320 Y ERCC5 n/a
9 TRCN0000050781 CCTGTATTAAAGCAACTCGAT pLKO.1 3361 CDS 100% 2.640 1.320 Y ERCC5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000123.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06178 pDONR223 100% 99.9% 100% None 138T>C n/a
2 ccsbBroad304_06178 pLX_304 0% 99.9% 100% V5 138T>C n/a
3 TRCN0000478964 ACTTTTTCTGAGTATACGTCTAAT pLX_317 9.6% 99.9% 100% V5 138T>C n/a
Download CSV