Transcript: Human NM_000148.3

Homo sapiens fucosyltransferase 1 (H blood group) (FUT1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
FUT1 (2523)
Length:
4246
CDS:
976..2073

Additional Resources:

NCBI RefSeq record:
NM_000148.3
NBCI Gene record:
FUT1 (2523)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000148.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036075 CATATCCATCAAGACAGCTTT pLKO.1 1051 CDS 100% 4.950 6.930 N FUT1 n/a
2 TRCN0000036078 TGGCCGGTTTGGTAATCAGAT pLKO.1 1233 CDS 100% 4.950 6.930 N FUT1 n/a
3 TRCN0000036074 CGCGGACTTGAGAGATCCTTT pLKO.1 1437 CDS 100% 4.950 3.465 N FUT1 n/a
4 TRCN0000036076 TCCACTCTGGACATTGGCTAA pLKO.1 2046 CDS 100% 4.050 2.835 N FUT1 n/a
5 TRCN0000036077 CGACTGGATGTCGGAGGAGTA pLKO.1 1416 CDS 100% 1.350 0.945 N FUT1 n/a
6 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 2810 3UTR 100% 4.950 2.475 Y n/a
7 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2881 3UTR 100% 5.625 2.813 Y EID2B n/a
8 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2881 3UTR 100% 5.625 2.813 Y KLHL30 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000148.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00597 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00597 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000478002 TTATTCCCACGCAACGGGATCTTC pLX_317 25.4% 100% 100% V5 n/a
Download CSV