Transcript: Human NM_000158.4

Homo sapiens 1,4-alpha-glucan branching enzyme 1 (GBE1), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
GBE1 (2632)
Length:
2941
CDS:
129..2237

Additional Resources:

NCBI RefSeq record:
NM_000158.4
NBCI Gene record:
GBE1 (2632)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000158.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296617 GACTGGAACATGGGCGATATA pLKO_005 1488 CDS 100% 13.200 18.480 N GBE1 n/a
2 TRCN0000083101 CGGAGTCTAAGAATTTATGAA pLKO.1 711 CDS 100% 5.625 7.875 N GBE1 n/a
3 TRCN0000083102 CCACGGAGTCTAAGAATTTAT pLKO.1 708 CDS 100% 15.000 12.000 N GBE1 n/a
4 TRCN0000290394 CCACGGAGTCTAAGAATTTAT pLKO_005 708 CDS 100% 15.000 12.000 N GBE1 n/a
5 TRCN0000083099 CGCTACAAGTTCCTAAATAAT pLKO.1 1854 CDS 100% 15.000 12.000 N GBE1 n/a
6 TRCN0000083100 CGTGGAATACAGCTTCATAAA pLKO.1 1671 CDS 100% 13.200 10.560 N GBE1 n/a
7 TRCN0000290454 CGTGGAATACAGCTTCATAAA pLKO_005 1671 CDS 100% 13.200 10.560 N GBE1 n/a
8 TRCN0000296619 ACGCTGTGTCCCGATTCTATA pLKO_005 1332 CDS 100% 13.200 9.240 N GBE1 n/a
9 TRCN0000083098 CCAAGCCATCAAGTGTCTGAA pLKO.1 2344 3UTR 100% 4.950 3.465 N GBE1 n/a
10 TRCN0000290393 CCAAGCCATCAAGTGTCTGAA pLKO_005 2344 3UTR 100% 4.950 3.465 N GBE1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000158.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06262 pDONR223 100% 99.9% 99.7% None 793A>T;1000A>G n/a
2 ccsbBroad304_06262 pLX_304 0% 99.9% 99.7% V5 793A>T;1000A>G n/a
Download CSV