Transcript: Human NM_000234.3

Homo sapiens DNA ligase 1 (LIG1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
LIG1 (3978)
Length:
3125
CDS:
162..2921

Additional Resources:

NCBI RefSeq record:
NM_000234.3
NBCI Gene record:
LIG1 (3978)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000234.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431836 ACCGGAAGCAAAGTCAGATTC pLKO_005 2851 CDS 100% 10.800 15.120 N LIG1 n/a
2 TRCN0000048494 CGGTTTATTCGAGTCCGTGAA pLKO.1 2781 CDS 100% 4.050 5.670 N LIG1 n/a
3 TRCN0000048493 CCTGCCAAGAACAACTATCAT pLKO.1 963 CDS 100% 5.625 4.500 N LIG1 n/a
4 TRCN0000439753 GCAGCTTTCACCTGCGAATAC pLKO_005 1842 CDS 100% 10.800 7.560 N LIG1 n/a
5 TRCN0000048495 GCTCAAGCTGAAGAAGGACTA pLKO.1 2387 CDS 100% 4.050 2.835 N LIG1 n/a
6 TRCN0000048496 CCAAGAAAGAGGGTAAAGCAA pLKO.1 193 CDS 100% 3.000 2.100 N LIG1 n/a
7 TRCN0000048497 CTGAAACCAATGTTGGCCCAT pLKO.1 1779 CDS 100% 2.160 1.512 N LIG1 n/a
8 TRCN0000439464 TCCTGGAGCAGTCAGTGAAAG pLKO_005 2290 CDS 100% 10.800 6.480 N LIG1 n/a
9 TRCN0000165520 GAGGAGGAAGAAGAGGAGAAA pLKO.1 618 CDS 100% 4.950 2.475 Y AP5B1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000234.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06523 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_06523 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480678 CGAATTCGAACCGTGTCGTTGAGG pLX_317 14.1% 100% 100% V5 n/a
Download CSV