Transcript: Human NM_000306.4

Homo sapiens POU class 1 homeobox 1 (POU1F1), transcript variant alpha, mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
POU1F1 (5449)
Length:
1488
CDS:
123..998

Additional Resources:

NCBI RefSeq record:
NM_000306.4
NBCI Gene record:
POU1F1 (5449)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000306.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000020712 CAAACAACAATCTGCCGATTT pLKO.1 621 CDS 100% 10.800 15.120 N POU1F1 n/a
2 TRCN0000020710 GCCATCAACCTATGGAGTGAT pLKO.1 311 CDS 100% 4.950 6.930 N POU1F1 n/a
3 TRCN0000422974 CAAACTGAAAGCAATATTATC pLKO_005 674 CDS 100% 13.200 9.240 N POU1F1 n/a
4 TRCN0000020711 CAAGTCTGAATCAGAGTTTAT pLKO.1 943 CDS 100% 13.200 9.240 N POU1F1 n/a
5 TRCN0000416639 GAACATCTTGAGTGCAGATAA pLKO_005 978 CDS 100% 13.200 9.240 N POU1F1 n/a
6 TRCN0000416935 ATGCTCTGGAGAGACACTTTG pLKO_005 802 CDS 100% 10.800 7.560 N POU1F1 n/a
7 TRCN0000020709 CCCGTTTCATTCCTTTCTCTT pLKO.1 1029 3UTR 100% 4.950 3.465 N POU1F1 n/a
8 TRCN0000020713 CCACACCTTGAGTCATGGATT pLKO.1 371 CDS 100% 4.950 2.970 N POU1F1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000306.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.