Transcript: Human NM_000332.3

Homo sapiens ataxin 1 (ATXN1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
ATXN1 (6310)
Length:
10636
CDS:
972..3419

Additional Resources:

NCBI RefSeq record:
NM_000332.3
NBCI Gene record:
ATXN1 (6310)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000332.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003729 CGCTTCAAATACGTTACCTTA pLKO.1 8404 3UTR 100% 4.950 3.960 N ATXN1 n/a
2 TRCN0000432266 ATTACTGTACTGTAGGCTAAA pLKO_005 3471 3UTR 100% 10.800 7.560 N ATXN1 n/a
3 TRCN0000430896 TTACAACAGGGAATAGGTTTA pLKO_005 1182 CDS 100% 10.800 7.560 N ATXN1 n/a
4 TRCN0000003730 ACCACCTTTGACTCTTCCTAA pLKO.1 3335 CDS 100% 4.950 3.465 N ATXN1 n/a
5 TRCN0000003732 CAGAACCAGTACGTCCACATT pLKO.1 1701 CDS 100% 4.950 3.465 N ATXN1 n/a
6 TRCN0000003733 CAGGAGGTTAAGATTTGCATT pLKO.1 3372 CDS 100% 4.950 3.465 N ATXN1 n/a
7 TRCN0000003731 AGAGGATTGAAGACAGCCATA pLKO.1 2818 CDS 100% 4.050 2.835 N ATXN1 n/a
8 TRCN0000240655 AGACTACAGCAGTCGTGATAC pLKO_005 2075 CDS 100% 10.800 7.560 N Atxn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000332.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01486 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01486 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471549 CCTCCGTGCCGGGAGGAAACCGGA pLX_317 16% 100% 100% V5 n/a
Download CSV