Transcript: Human NM_000363.5

Homo sapiens troponin I3, cardiac type (TNNI3), mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
TNNI3 (7137)
Length:
843
CDS:
144..776

Additional Resources:

NCBI RefSeq record:
NM_000363.5
NBCI Gene record:
TNNI3 (7137)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000363.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414622 ATCGATGCACTGAGTGGAATG pLKO_005 726 CDS 100% 6.000 8.400 N TNNI3 n/a
2 TRCN0000083333 GAGATACGACATAGAGGCAAA pLKO.1 473 CDS 100% 4.050 5.670 N TNNI3 n/a
3 TRCN0000083334 CTTTGACCTTCGAGGCAAGTT pLKO.1 539 CDS 100% 4.950 3.465 N TNNI3 n/a
4 TRCN0000083337 GATGAAGAGAGATACGACATA pLKO.1 465 CDS 100% 4.950 3.465 N TNNI3 n/a
5 TRCN0000443359 ACTGGCGCAAGAACATCGATG pLKO_005 712 CDS 100% 4.050 2.835 N TNNI3 n/a
6 TRCN0000083336 AGAGTGAGGATCTCTGCAGAT pLKO.1 579 CDS 100% 4.050 2.835 N TNNI3 n/a
7 TRCN0000438242 CACGGAGATTGCAGATCTGAC pLKO_005 509 CDS 100% 4.050 2.835 N TNNI3 n/a
8 TRCN0000417666 TGCTGCAGATTGCAAAGCAAG pLKO_005 301 CDS 100% 4.050 2.835 N TNNI3 n/a
9 TRCN0000108916 CCACCTCAAGCAGGTGAAGAA pLKO.1 656 CDS 100% 0.495 0.347 N Tnni3 n/a
10 TRCN0000083335 ACTCAGAAGATCTTTGACCTT pLKO.1 528 CDS 100% 2.640 1.584 N TNNI3 n/a
11 TRCN0000415876 CTCTGCAGATGCCATGATGCA pLKO_005 590 CDS 100% 2.640 1.584 N Tnni3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000363.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01691 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01691 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473449 ACCGGCGGCTGCCCGCTGTTTTGC pLX_317 84% 100% 100% V5 n/a
Download CSV