Transcript: Human NM_000423.3

Homo sapiens keratin 2 (KRT2), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
KRT2 (3849)
Length:
2450
CDS:
70..1989

Additional Resources:

NCBI RefSeq record:
NM_000423.3
NBCI Gene record:
KRT2 (3849)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000423.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417956 AGGATCTTGTGGAGGATTATA pLKO_005 842 CDS 100% 15.000 10.500 N KRT2 n/a
2 TRCN0000419708 CTCTCCAAACCAGTTAGTTAG pLKO_005 2156 3UTR 100% 10.800 7.560 N KRT2 n/a
3 TRCN0000108430 GCCTCTTTGCATTGCCCATTT pLKO.1 2262 3UTR 100% 10.800 7.560 N KRT2 n/a
4 TRCN0000108433 GTGGACAATGCCTACATGATA pLKO.1 934 CDS 100% 5.625 3.938 N KRT2 n/a
5 TRCN0000108434 CAGTGTAAGAATGTGCAAGAT pLKO.1 1315 CDS 100% 4.950 3.465 N KRT2 n/a
6 TRCN0000108432 GTTCTCTATGATGCGGAGATA pLKO.1 1012 CDS 100% 4.950 3.465 N KRT2 n/a
7 TRCN0000108431 CCATTTCATCAAATGTGGCAT pLKO.1 1589 CDS 100% 0.264 0.158 N KRT2 n/a
8 TRCN0000089609 CATGTGAAGAAGCAGTGTATA pLKO.1 1303 CDS 100% 13.200 9.240 N Krt2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000423.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00916 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00916 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000474806 TTCCAAGGCCCCAATCTTACTTAA pLX_317 19.2% 100% 100% V5 n/a
Download CSV