Transcript: Human NM_000435.3

Homo sapiens notch receptor 3 (NOTCH3), mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
NOTCH3 (4854)
Length:
8680
CDS:
91..7056

Additional Resources:

NCBI RefSeq record:
NM_000435.3
NBCI Gene record:
NOTCH3 (4854)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000435.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000363291 GGTGATCGGCTCGGTAGTAAT pLKO_005 4818 CDS 100% 13.200 18.480 N NOTCH3 n/a
2 TRCN0000020238 CCAATGCCAACTGAAGAGGAT pLKO.1 5503 CDS 100% 2.640 3.696 N NOTCH3 n/a
3 TRCN0000020234 CCAGTTCACCTGTATCTGTAT pLKO.1 1443 CDS 100% 4.950 3.960 N NOTCH3 n/a
4 TRCN0000363264 TCTGCAAGGACCGAGTCAATG pLKO_005 1538 CDS 100% 10.800 7.560 N NOTCH3 n/a
5 TRCN0000363316 TTTGTAACGTGGAGATCAATG pLKO_005 2048 CDS 100% 10.800 7.560 N NOTCH3 n/a
6 TRCN0000020235 CTCGGTAGTAATGCTGGAGAT pLKO.1 4827 CDS 100% 4.050 2.835 N NOTCH3 n/a
7 TRCN0000020237 CTGTGACACAAATCCGGTGAA pLKO.1 1185 CDS 100% 4.050 2.835 N NOTCH3 n/a
8 TRCN0000020236 GCCAATAAGGACATGCAGGAT pLKO.1 5977 CDS 100% 2.640 1.848 N NOTCH3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000435.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489840 GCGCTGGCTCACACTAGACAAAAG pLX_317 3.8% 99.8% 99.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV