Transcript: Human NM_000480.3

Homo sapiens adenosine monophosphate deaminase 3 (AMPD3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
AMPD3 (272)
Length:
4357
CDS:
332..2662

Additional Resources:

NCBI RefSeq record:
NM_000480.3
NBCI Gene record:
AMPD3 (272)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000480.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245010 ATCCGGATGGCATTCCGATAT pLKO_005 2567 CDS 100% 10.800 15.120 N AMPD3 n/a
2 TRCN0000245009 ACAGTTTGTTCCTCGAATATT pLKO_005 2268 CDS 100% 15.000 10.500 N AMPD3 n/a
3 TRCN0000245011 ATGCTATCTTACAGCTAATTA pLKO_005 4172 3UTR 100% 15.000 10.500 N AMPD3 n/a
4 TRCN0000051968 CCCGGATTTATGACATATTTA pLKO.1 1779 CDS 100% 15.000 10.500 N AMPD3 n/a
5 TRCN0000245008 CCCGGATTTATGACATATTTA pLKO_005 1779 CDS 100% 15.000 10.500 N AMPD3 n/a
6 TRCN0000051970 CCTCAAGAAGAGTCCGGTATT pLKO.1 2191 CDS 100% 10.800 7.560 N AMPD3 n/a
7 TRCN0000051972 GCGGAGAAGGTGTTTGCTAAA pLKO.1 419 CDS 100% 10.800 7.560 N AMPD3 n/a
8 TRCN0000051969 GCATCCTCTTTGTGTATGATA pLKO.1 1038 CDS 100% 5.625 3.938 N AMPD3 n/a
9 TRCN0000051971 GCATTCCGATATGAGACCTTA pLKO.1 2576 CDS 100% 4.950 3.465 N AMPD3 n/a
10 TRCN0000257159 GGTCACCATCAGCGGAGATTA pLKO_005 754 CDS 100% 13.200 7.920 N AMPD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000480.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00064 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00064 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000469692 GCTGCTGGAGACCATGCACCTTAG pLX_317 17.6% 100% 100% V5 n/a
Download CSV