Transcript: Human NM_000524.3

Homo sapiens 5-hydroxytryptamine receptor 1A (HTR1A), mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
HTR1A (3350)
Length:
2245
CDS:
574..1842

Additional Resources:

NCBI RefSeq record:
NM_000524.3
NBCI Gene record:
HTR1A (3350)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000524.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000368420 GGTTCTCTATGGGCGCATATT pLKO_005 1209 CDS 100% 13.200 18.480 N HTR1A n/a
2 TRCN0000357484 TGCAGAACGTGGCCAATTATC pLKO_005 773 CDS 100% 13.200 18.480 N HTR1A n/a
3 TRCN0000009083 TGGTTCTCTATGGGCGCATAT pLKO.1 1208 CDS 100% 10.800 15.120 N HTR1A n/a
4 TRCN0000357485 ATCATGGCTACACTATCTATT pLKO_005 1148 CDS 100% 13.200 9.240 N HTR1A n/a
5 TRCN0000009082 GCAAGGATCATGGCTACACTA pLKO.1 1142 CDS 100% 4.950 3.465 N HTR1A n/a
6 TRCN0000009081 CCAATTATCTTATTGGCTCTT pLKO.1 785 CDS 100% 0.405 0.284 N HTR1A n/a
7 TRCN0000009080 CCCGCCTCTTTCGAGAGGAAA pLKO.1 1525 CDS 100% 0.165 0.116 N HTR1A n/a
8 TRCN0000009084 CCAGGTAACCTGCGACCTGTT pLKO.1 888 CDS 100% 0.135 0.081 N HTR1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000524.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488771 AACGCGCTTTCATGGCAAGTGTTC pLX_317 24.9% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV