Transcript: Human NM_000530.8

Homo sapiens myelin protein zero (MPZ), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
MPZ (4359)
Length:
1951
CDS:
64..810

Additional Resources:

NCBI RefSeq record:
NM_000530.8
NBCI Gene record:
MPZ (4359)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000530.8, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083731 GTCACGCTGTATGTCTTTGAA pLKO.1 487 CDS 100% 5.625 7.875 N MPZ n/a
2 TRCN0000083729 GCCATTTCGATCTTCCACTAT pLKO.1 289 CDS 100% 4.950 6.930 N MPZ n/a
3 TRCN0000429200 AGTCTCGCAAGGATAAGAAAT pLKO_005 788 CDS 100% 13.200 9.240 N Mpz n/a
4 TRCN0000083728 CCTCCCTTTGAGATGTAAGTT pLKO.1 1109 3UTR 100% 5.625 3.938 N MPZ n/a
5 TRCN0000083732 GAGTCTCGCAAGGATAAGAAA pLKO.1 787 CDS 100% 5.625 3.938 N MPZ n/a
6 TRCN0000083730 TCACGCTGTATGTCTTTGAAA pLKO.1 488 CDS 100% 5.625 3.938 N MPZ n/a
7 TRCN0000090117 CAACCTAGACTACAGTGACAA pLKO.1 408 CDS 100% 4.950 3.465 N Mpz n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000530.8, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06594 pDONR223 100% 95.9% 95.7% None 0_1ins30;743A>C n/a
2 ccsbBroad304_06594 pLX_304 0% 95.9% 95.7% V5 0_1ins30;743A>C n/a
3 TRCN0000472044 GTCAGCCCGTTAATGCGCGCCCTC pLX_317 62.2% 95.9% 95.7% V5 0_1ins30;743A>C n/a
Download CSV