Transcript: Human NM_000539.3

Homo sapiens rhodopsin (RHO), mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
RHO (6010)
Length:
2768
CDS:
96..1142

Additional Resources:

NCBI RefSeq record:
NM_000539.3
NBCI Gene record:
RHO (6010)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000539.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003752 ACCTCCTGATAGTGAACATTT pLKO.1 1841 3UTR 100% 13.200 18.480 N RHO n/a
2 TRCN0000355894 AGGACTCTGTGGCCGACTATA pLKO_005 1152 3UTR 100% 13.200 18.480 N RHO n/a
3 TRCN0000003749 TCTGCATGGATACTTCGTCTT pLKO.1 389 CDS 100% 4.050 5.670 N RHO n/a
4 TRCN0000355895 CTACAACCCTGTCATCTATAT pLKO_005 995 CDS 100% 13.200 9.240 N RHO n/a
5 TRCN0000355826 TGACCATCCCAGCGTTCTTTG pLKO_005 958 CDS 100% 10.800 7.560 N RHO n/a
6 TRCN0000003750 CAGCGTGGCATTCTACATCTT pLKO.1 902 CDS 100% 4.950 3.465 N RHO n/a
7 TRCN0000003748 CGGAGGTCAACAACGAGTCTT pLKO.1 682 CDS 100% 4.950 3.465 N RHO n/a
8 TRCN0000003751 CATCAACTTCCTCACGCTCTA pLKO.1 254 CDS 100% 4.050 2.835 N RHO n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000539.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488933 AGTTCATCGCAAGCACCCGTTTCT pLX_317 35.4% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV