Transcript: Human NM_000596.4

Homo sapiens insulin like growth factor binding protein 1 (IGFBP1), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
IGFBP1 (3484)
Length:
1514
CDS:
166..945

Additional Resources:

NCBI RefSeq record:
NM_000596.4
NBCI Gene record:
IGFBP1 (3484)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000596.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150497 GAGGACGGTTAACTTGTATAT pLKO.1 1329 3UTR 100% 13.200 18.480 N IGFBP1 n/a
2 TRCN0000073729 GAAGAGGATCATTCCATCCTT pLKO.1 598 CDS 100% 0.300 0.240 N IGFBP1 n/a
3 TRCN0000152645 GAAGAGGATCATTCCATCCTT pLKO.1 598 CDS 100% 0.300 0.240 N IGFBP1 n/a
4 TRCN0000073732 CAGGAGAAGAAATTTCCAAAT pLKO.1 746 CDS 100% 10.800 7.560 N IGFBP1 n/a
5 TRCN0000222539 CCTGCCAAACTGCAACAAGAA pLKO.1 771 CDS 100% 4.950 3.465 N IGFBP1 n/a
6 TRCN0000152001 CCTGGATAATTTCCATCTGAT pLKO.1 567 CDS 100% 4.950 3.465 N IGFBP1 n/a
7 TRCN0000153843 CTACAGAGTCGTAGAGAGTTT pLKO.1 705 CDS 100% 4.950 3.465 N IGFBP1 n/a
8 TRCN0000073731 GCCCTGCCGAATAGAACTCTA pLKO.1 687 CDS 100% 4.950 3.465 N IGFBP1 n/a
9 TRCN0000153699 CCAAACTGCAACAAGAATGGA pLKO.1 775 CDS 100% 3.000 2.100 N IGFBP1 n/a
10 TRCN0000073730 CAGTACCTATGATGGCTCGAA pLKO.1 630 CDS 100% 2.640 1.848 N IGFBP1 n/a
11 TRCN0000150969 CCACCATTCACATTTGATGTA pLKO.1 1351 3UTR 100% 4.950 2.970 N IGFBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000596.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06432 pDONR223 100% 99.8% 99.6% None 452T>C n/a
2 ccsbBroad304_06432 pLX_304 0% 99.8% 99.6% V5 452T>C n/a
3 TRCN0000480938 TCCGGGCTATGGCAATGTTAGACA pLX_317 57.4% 99.8% 99.6% V5 452T>C n/a
Download CSV