Transcript: Human NM_000614.4

Homo sapiens ciliary neurotrophic factor (CNTF), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
CNTF (1270)
Length:
1902
CDS:
89..691

Additional Resources:

NCBI RefSeq record:
NM_000614.4
NBCI Gene record:
CNTF (1270)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000614.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412349 GTAACCTCTACAGGCATTTAA pLKO_005 1013 3UTR 100% 15.000 7.500 Y CNTF n/a
2 TRCN0000431617 GTTGAAGGACTACAGGTATTT pLKO_005 836 3UTR 100% 13.200 6.600 Y CNTF n/a
3 TRCN0000435460 GGTGACTTCCATCAAGCTATA pLKO_005 395 CDS 100% 10.800 5.400 Y CNTF n/a
4 TRCN0000059175 GAGCCATTATATTGCTAACAA pLKO.1 658 CDS 100% 5.625 2.813 Y CNTF n/a
5 TRCN0000059174 CGACTCCAAGAGAACCTTCAA pLKO.1 302 CDS 100% 4.950 2.475 Y CNTF n/a
6 TRCN0000059173 GCATACCAGATAGAGGAGTTA pLKO.1 446 CDS 100% 4.950 2.475 Y CNTF n/a
7 TRCN0000059176 GCTGCCTTTGCATACCAGATA pLKO.1 437 CDS 100% 4.950 2.475 Y CNTF n/a
8 TRCN0000059177 GACTGCTCTTACGGAATCCTA pLKO.1 181 CDS 100% 3.000 1.500 Y CNTF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000614.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00340 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00340 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472514 TTTACCGGTTTAAAATATGTATTT pLX_317 70.3% 100% 100% V5 n/a
Download CSV