Transcript: Human NM_000643.2

Homo sapiens amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase (AGL), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-23
Taxon:
Homo sapiens (human)
Gene:
AGL (178)
Length:
7169
CDS:
199..4797

Additional Resources:

NCBI RefSeq record:
NM_000643.2
NBCI Gene record:
AGL (178)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000643.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252245 TTCCGATTAGGCCCAACTTTA pLKO_005 295 CDS 100% 13.200 18.480 N Agl n/a
2 TRCN0000035080 CGGGTTCAGAAGTTTACCTAA pLKO.1 1619 CDS 100% 4.950 6.930 N AGL n/a
3 TRCN0000035079 GCCCTTAAATATGCAGGTCTT pLKO.1 2986 CDS 100% 4.050 5.670 N AGL n/a
4 TRCN0000412594 CATCCAGAATGTGCCTATAAT pLKO_005 889 CDS 100% 15.000 12.000 N AGL n/a
5 TRCN0000431053 CTATCAGCTCAGGCCTAATTT pLKO_005 4320 CDS 100% 15.000 10.500 N AGL n/a
6 TRCN0000419324 ATATTAACACCACGTACTATA pLKO_005 5207 3UTR 100% 13.200 9.240 N AGL n/a
7 TRCN0000035081 GCTATGTAGAAGCCAGGAATA pLKO.1 3545 CDS 100% 10.800 7.560 N AGL n/a
8 TRCN0000035082 CCCTTGCCAATCAGTTAGAAT pLKO.1 719 CDS 100% 5.625 3.938 N AGL n/a
9 TRCN0000035083 GCTACTATTCTTGAGACACTT pLKO.1 4765 CDS 100% 4.950 3.465 N AGL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000643.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00038 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00038 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475911 AGGACCATAGCAGTTATTCAGTTT pLX_317 6.3% 100% 100% V5 n/a
Download CSV