Transcript: Human NM_000698.5

Homo sapiens arachidonate 5-lipoxygenase (ALOX5), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
ALOX5 (240)
Length:
2519
CDS:
65..2089

Additional Resources:

NCBI RefSeq record:
NM_000698.5
NBCI Gene record:
ALOX5 (240)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000698.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413661 TCAAGATCAGCAACACTATTT pLKO_005 702 CDS 100% 13.200 18.480 N ALOX5 n/a
2 TRCN0000056571 CCCGTGATATCCAGTTTGATA pLKO.1 558 CDS 100% 5.625 7.875 N ALOX5 n/a
3 TRCN0000056569 CGGGAGATGAGAACCCTATTT pLKO.1 1059 CDS 100% 13.200 10.560 N ALOX5 n/a
4 TRCN0000056570 CGAGATGACCAAATTCACATT pLKO.1 425 CDS 100% 4.950 3.960 N ALOX5 n/a
5 TRCN0000412516 GACCACTGATAGATGTCTATT pLKO_005 2360 3UTR 100% 13.200 9.240 N ALOX5 n/a
6 TRCN0000254914 TTGGCCCGAGATGACCAAATT pLKO_005 419 CDS 100% 13.200 9.240 N Alox5 n/a
7 TRCN0000434016 GGAATGACTTCGCCGACTTTG pLKO_005 669 CDS 100% 10.800 7.560 N ALOX5 n/a
8 TRCN0000056568 CCTGTTCATCAACCGCTTCAT pLKO.1 628 CDS 100% 4.950 3.465 N ALOX5 n/a
9 TRCN0000056572 CGAGGTGGTAGACATCTACTA pLKO.1 1525 CDS 100% 4.950 3.465 N ALOX5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000698.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00056 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00056 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480364 GTTAATATGCACTGCGTAAGTTCG pLX_317 19.1% 100% 100% V5 n/a
Download CSV