Transcript: Human NM_000714.6

Homo sapiens translocator protein (TSPO), transcript variant PBR, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
TSPO (706)
Length:
836
CDS:
76..585

Additional Resources:

NCBI RefSeq record:
NM_000714.6
NBCI Gene record:
TSPO (706)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000714.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060433 CCACACTCAACTACTGCGTAT pLKO.1 518 CDS 100% 4.050 5.670 N TSPO n/a
2 TRCN0000299911 CCACACTCAACTACTGCGTAT pLKO_005 518 CDS 100% 4.050 5.670 N TSPO n/a
3 TRCN0000331334 CGTCACGCTTTCATGACCACT pLKO_005 650 3UTR 100% 2.640 3.696 N TSPO n/a
4 TRCN0000060437 CCCGACAAATGGGCTGGGCCT pLKO.1 380 CDS 100% 0.000 0.000 N TSPO n/a
5 TRCN0000060434 CTTCTTTGGTGCCCGACAAAT pLKO.1 369 CDS 100% 13.200 9.240 N TSPO n/a
6 TRCN0000299912 CTTCTTTGGTGCCCGACAAAT pLKO_005 369 CDS 100% 13.200 9.240 N TSPO n/a
7 TRCN0000060435 CGGCTCCTACCTGGTCTGGAA pLKO.1 261 CDS 100% 0.000 0.000 N TSPO n/a
8 TRCN0000299975 CGGCTCCTACCTGGTCTGGAA pLKO_005 261 CDS 100% 0.000 0.000 N TSPO n/a
9 TRCN0000331333 AGGCTTCACAGAGAAGGCTGT pLKO_005 291 CDS 100% 2.160 1.296 N TSPO n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000714.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05908 pDONR223 100% 99.6% 98.8% None 439A>G;485G>A n/a
2 ccsbBroad304_05908 pLX_304 0% 99.6% 98.8% V5 439A>G;485G>A n/a
3 TRCN0000473925 AATCCTCACGCTGGACTAGGTGCT pLX_317 77.6% 99.6% 98.8% V5 439A>G;485G>A n/a
Download CSV