Transcript: Human NM_000775.4

Homo sapiens cytochrome P450 family 2 subfamily J member 2 (CYP2J2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
CYP2J2 (1573)
Length:
1879
CDS:
28..1536

Additional Resources:

NCBI RefSeq record:
NM_000775.4
NBCI Gene record:
CYP2J2 (1573)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000775.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000432678 TCTACTGTCTCGTCCGAATTA pLKO_005 1693 3UTR 100% 13.200 18.480 N CYP2J2 n/a
2 TRCN0000064210 GCGAGAACATATCTTTAAGAA pLKO.1 375 CDS 100% 5.625 7.875 N CYP2J2 n/a
3 TRCN0000433942 GCTGTTCCTCAGGTGTAATAT pLKO_005 1519 CDS 100% 15.000 12.000 N CYP2J2 n/a
4 TRCN0000429996 CTGCGATGGGCTCTGCTTTAT pLKO_005 985 CDS 100% 13.200 10.560 N CYP2J2 n/a
5 TRCN0000064212 GCCAGGACTGAGCTGTTTATT pLKO.1 1387 CDS 100% 15.000 10.500 N CYP2J2 n/a
6 TRCN0000064208 CCTCATTTCAAGATCAACAAT pLKO.1 565 CDS 100% 5.625 3.938 N CYP2J2 n/a
7 TRCN0000064211 GCAGAGAATGGGCAACATCAT pLKO.1 1134 CDS 100% 4.950 3.465 N CYP2J2 n/a
8 TRCN0000064209 CCTGAAGTTTAGAATGGGTAT pLKO.1 1467 CDS 100% 4.050 2.835 N CYP2J2 n/a
9 TRCN0000126472 CCCTACACCAATGCTGTCATT pLKO.1 1105 CDS 100% 4.950 3.465 N Cyp2d9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000775.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00410 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00410 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466329 CAAGTTTAACCACGTTAGCTCTGC pLX_317 25.6% 100% 100% V5 n/a
Download CSV