Transcript: Human NM_000793.6

Homo sapiens iodothyronine deiodinase 2 (DIO2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DIO2 (1734)
Length:
6374
CDS:
390..1187

Additional Resources:

NCBI RefSeq record:
NM_000793.6
NBCI Gene record:
DIO2 (1734)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000793.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294313 GTATTGCCTTGGCTCTATTTG pLKO_005 1601 3UTR 100% 13.200 18.480 N DIO2 n/a
2 TRCN0000084063 GCTCTCTATGACTCGGTCATT pLKO.1 465 CDS 100% 4.950 6.930 N DIO2 n/a
3 TRCN0000286958 GCTCTCTATGACTCGGTCATT pLKO_005 465 CDS 100% 4.950 6.930 N DIO2 n/a
4 TRCN0000084065 GCCTTTGAACGTGTGTGCATT pLKO.1 1065 CDS 100% 4.950 3.960 N DIO2 n/a
5 TRCN0000286957 GCCTTTGAACGTGTGTGCATT pLKO_005 1065 CDS 100% 4.950 3.960 N DIO2 n/a
6 TRCN0000294370 GCTGGTTAAAGGTATGATTAT pLKO_005 1203 3UTR 100% 13.200 9.240 N DIO2 n/a
7 TRCN0000084064 CCCTTCTCCTACAACCTTCAA pLKO.1 1125 CDS 100% 4.950 3.465 N DIO2 n/a
8 TRCN0000084066 CAGGTGAAATTGGGTGAGGAT pLKO.1 609 CDS 100% 2.640 1.848 N DIO2 n/a
9 TRCN0000084067 TGAGGTGAAGAAGCACCAGAA pLKO.1 929 CDS 100% 4.050 2.430 N DIO2 n/a
10 TRCN0000286959 TGAGGTGAAGAAGCACCAGAA pLKO_005 929 CDS 100% 4.050 2.430 N DIO2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000793.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13844 pDONR223 100% 96.9% 100% None 453_454insA;795_796ins24 n/a
2 ccsbBroad304_13844 pLX_304 0% 96.9% 100% V5 (not translated due to prior stop codon) 453_454insA;795_796ins24 n/a
3 TRCN0000476920 AGGATACCTACAGGCATTCCCACC pLX_317 34.5% 96.9% 100% V5 (not translated due to prior stop codon) 453_454insA;795_796ins24 n/a
Download CSV