Construct: ORF TRCN0000476920
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007530.1_s317c1
- Derived from:
- ccsbBroadEn_13844
- DNA Barcode:
- AGGATACCTACAGGCATTCCCACC
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- DIO2 (1734)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000476920
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1734 | DIO2 | iodothyronine deiodinase 2 | NM_013989.5 | 99.8% | 100% | 453_454insA |
| 2 | human | 1734 | DIO2 | iodothyronine deiodinase 2 | NM_000793.6 | 96.9% | 100% | 453_454insA;795_796ins24 |
| 3 | human | 1734 | DIO2 | iodothyronine deiodinase 2 | NM_001324462.2 | 96.9% | 100% | 453_454insA;795_796ins24 |
| 4 | human | 1734 | DIO2 | iodothyronine deiodinase 2 | NM_001366496.1 | 96.9% | 100% | 453_454insA;795_796ins24 |
| 5 | human | 1734 | DIO2 | iodothyronine deiodinase 2 | NR_158990.1 | 13.3% | (many diffs) | |
| 6 | human | 1734 | DIO2 | iodothyronine deiodinase 2 | NR_158991.1 | 13% | (many diffs) | |
| 7 | mouse | 13371 | Dio2 | deiodinase, iodothyronine, ... | NM_010050.3 | 86.4% | 87.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 465
- ORF length:
- 396
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gggcatcctc agcgtagact tgctgatcac actgcaaatt ctgccagttt 121 ttttctccaa ctgcctcttc ctggctctct atgactcggt cattctgctc aagcacgtgg 181 tgctgctgtt gagccgctcc aagtccactc gcggagagtg gcggcgcatg ctgacctcag 241 agggactgcg ctgcgtctgg aagagcttcc tcctcgatgc ctacaaacag gtgaaattgg 301 gtgaggatgc ccccaattcc agtgtggtgc atgtctccag tacagaagga ggtgacaaca 361 gtggcaatgg tacccaggag aagatagctg agggagccac atgccacctt cttgactttg 421 ccagccctga gcgcccacta gtggtcaact ttggctcagc cacttgacct cctttcacga 481 gccagctgcc agccttccgc aaactggtgg aagagttctc catcagtggc tgacttcctg 541 ctggtctaca ttgatgaggc tcatccatca gatggctggg cgataccggg ggactcctct 601 ttgtctttTG AGGTGAAGAA GCACCAGAAC CAGGAAGATC GATGTGCAGC AGCCCAGCAG 661 CTTCTGGAGC GTTTCTCCTT GCCGCCCCAG TGCCGAGTTG TGGCTGACCG CATGGACAAT 721 AACGCCAACA TAGCTTACGG GGTAGCCTTT GAACGTGTGT GCATTGTGCA GAGACAGAAA 781 ATTGCTTATC TGGGAGGAAA GGGCCCCTTC TCCTACAACC TTCAAGAAGT CCGGCATTGG 841 CTGGAGAAGA ATTTCAGCAA GAGATGAAAG AAAACTAGAT TAGCTGGTTT GCCAACTTTC 901 TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT 961 ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT 1021 TGTGGAAAGG ACGAAGGATA CCTACAGGCA TTCCCACCAC GCGTTAAGTC gacaatcaac 1081 ctctggatta caaaatttgt gaaagatt