Transcript: Human NM_000815.5

Homo sapiens gamma-aminobutyric acid type A receptor delta subunit (GABRD), mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
GABRD (2563)
Length:
1914
CDS:
80..1438

Additional Resources:

NCBI RefSeq record:
NM_000815.5
NBCI Gene record:
GABRD (2563)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000815.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061580 CGGTTACTCATCGGAGGACAT pLKO.1 634 CDS 100% 4.050 5.670 N GABRD n/a
2 TRCN0000061579 GATGAATGACATCGGCGACTA pLKO.1 151 CDS 100% 4.050 5.670 N GABRD n/a
3 TRCN0000061582 GCTGACGATGACCACGCTCAT pLKO.1 940 CDS 100% 1.350 1.890 N GABRD n/a
4 TRCN0000061581 TGCTCATTTCAACGCCGACTA pLKO.1 1069 CDS 100% 4.050 3.240 N GABRD n/a
5 TRCN0000061578 CGCAGACACCATTGACATTTA pLKO.1 1348 CDS 100% 13.200 9.240 N GABRD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000815.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06244 pDONR223 100% 99.9% 100% None 330T>C n/a
2 ccsbBroad304_06244 pLX_304 0% 99.9% 100% V5 330T>C n/a
3 TRCN0000472474 GATAAATCTGAACAACTCAACATT pLX_317 34.3% 99.9% 100% V5 330T>C n/a
Download CSV