Transcript: Human NM_000834.4

Homo sapiens glutamate ionotropic receptor NMDA type subunit 2B (GRIN2B), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
GRIN2B (2904)
Length:
30348
CDS:
448..4902

Additional Resources:

NCBI RefSeq record:
NM_000834.4
NBCI Gene record:
GRIN2B (2904)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000834.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434318 GAGAATCTACCAGTCCAATAT pLKO_005 1428 CDS 100% 13.200 10.560 N GRIN2B n/a
2 TRCN0000063532 GCACCCGAAACTGGTGATAAT pLKO.1 1521 CDS 100% 13.200 9.240 N GRIN2B n/a
3 TRCN0000425036 GCAGCAGTGCTGAACTATATG pLKO_005 2644 CDS 100% 13.200 9.240 N GRIN2B n/a
4 TRCN0000063528 CCTCTATGATAATGGCAGATA pLKO.1 836 CDS 100% 4.950 3.465 N GRIN2B n/a
5 TRCN0000063529 GCTATGGCATTGCCATCCAAA pLKO.1 2729 CDS 100% 4.950 3.465 N GRIN2B n/a
6 TRCN0000063530 GCACCATTTGTCATTGTGGAA pLKO.1 1687 CDS 100% 2.640 1.848 N GRIN2B n/a
7 TRCN0000063531 CCGATGTCTCTGACATCTCAA pLKO.1 3620 CDS 100% 0.495 0.347 N GRIN2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000834.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000476032 CAGCTATCTCGCAGTATGCAGTTT pLX_317 8.5% 99.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV