Transcript: Human NM_000921.4

Homo sapiens phosphodiesterase 3A (PDE3A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
PDE3A (5139)
Length:
7319
CDS:
41..3466

Additional Resources:

NCBI RefSeq record:
NM_000921.4
NBCI Gene record:
PDE3A (5139)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000921.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000048784 GCCGTATTCTTAGTCAGGTAT pLKO.1 2163 CDS 100% 4.950 6.930 N PDE3A n/a
2 TRCN0000048785 CCTCTGATTATGAAACCAATA pLKO.1 1905 CDS 100% 10.800 8.640 N PDE3A n/a
3 TRCN0000048786 GCCAGAGTATAACTTCTTAAT pLKO.1 2680 CDS 100% 13.200 9.240 N PDE3A n/a
4 TRCN0000048783 GCTCCACAATTTAGTAACATT pLKO.1 3806 3UTR 100% 5.625 3.938 N PDE3A n/a
5 TRCN0000048787 CCTATGATTCAGCAGGACTAA pLKO.1 3084 CDS 100% 4.950 3.465 N PDE3A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000921.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06701 pDONR223 100% 99.9% 100% None 1194C>T;2172C>G n/a
2 ccsbBroad304_06701 pLX_304 0% 99.9% 100% V5 1194C>T;2172C>G n/a
3 TRCN0000479425 ACCAATCCGTGTGAATCCACAGTA pLX_317 7.4% 99.9% 100% V5 1194C>T;2172C>G n/a
Download CSV