Transcript: Human NM_000950.3

Homo sapiens proline rich and Gla domain 1 (PRRG1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
PRRG1 (5638)
Length:
4491
CDS:
165..821

Additional Resources:

NCBI RefSeq record:
NM_000950.3
NBCI Gene record:
PRRG1 (5638)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000950.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000056433 TCCGTTAATCTTTGGCCTCTT pLKO.1 419 CDS 100% 4.050 3.240 N PRRG1 n/a
2 TRCN0000289668 TCCGTTAATCTTTGGCCTCTT pLKO_005 419 CDS 100% 4.050 3.240 N PRRG1 n/a
3 TRCN0000296367 TTTCCCTCAGCACCTTAATAT pLKO_005 527 CDS 100% 15.000 10.500 N PRRG1 n/a
4 TRCN0000296309 CCATTAACTTCTACCTAAATC pLKO_005 1155 3UTR 100% 13.200 9.240 N PRRG1 n/a
5 TRCN0000056434 GAAATAAGACAGGGCAACATT pLKO.1 243 CDS 100% 5.625 3.938 N PRRG1 n/a
6 TRCN0000056437 AGGAAGTGACTGGTTTCAGTT pLKO.1 386 CDS 100% 4.950 3.465 N PRRG1 n/a
7 TRCN0000289669 AGGAAGTGACTGGTTTCAGTT pLKO_005 386 CDS 100% 4.950 3.465 N PRRG1 n/a
8 TRCN0000056436 GAGGAGTGAAACAGAACCTCA pLKO.1 710 CDS 100% 2.640 1.848 N PRRG1 n/a
9 TRCN0000289667 GAGGAGTGAAACAGAACCTCA pLKO_005 710 CDS 100% 2.640 1.848 N PRRG1 n/a
10 TRCN0000367345 CTGTGGTCACCACCATCAAAT pLKO_005 799 CDS 100% 13.200 7.920 N Prrg1 n/a
11 TRCN0000056435 TCTCCAGGCTTTCTGGGATAT pLKO.1 597 CDS 100% 10.800 6.480 N PRRG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000950.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01301 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01301 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473678 TGTAACCGCAAACGGCCGGTCAAA pLX_317 32.9% 100% 100% V5 n/a
Download CSV