Transcript: Human NM_000976.4

Homo sapiens ribosomal protein L12 (RPL12), mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
RPL12 (6136)
Length:
634
CDS:
90..587

Additional Resources:

NCBI RefSeq record:
NM_000976.4
NBCI Gene record:
RPL12 (6136)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000976.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421705 TTGATGAGATTGTCAACATTG pLKO_005 406 CDS 100% 10.800 6.480 N RPL12 n/a
2 TRCN0000117445 CATTAAACACAGTGGGAATAT pLKO.1 380 CDS 100% 13.200 6.600 Y RPL12 n/a
3 TRCN0000419530 GTGGAATGCCCAGCCAGTTAA pLKO_005 567 CDS 100% 13.200 6.600 Y RPL12 n/a
4 TRCN0000430045 AGAACAGACAGGCCCAGATTG pLKO_005 283 CDS 100% 10.800 5.400 Y RPL12 n/a
5 TRCN0000117444 GAGAACTCTCTGGAACCATTA pLKO.1 457 CDS 100% 10.800 5.400 Y RPL12 n/a
6 TRCN0000117442 CCACCAAGAGACAGAAAGAAA pLKO.1 351 CDS 100% 5.625 2.813 Y RPL12 n/a
7 TRCN0000117446 CCTGAGGATTACAGTGAAACT pLKO.1 254 CDS 100% 4.950 2.475 Y RPL12 n/a
8 TRCN0000104320 CCTGATCATCAAAGCCCTCAA pLKO.1 326 CDS 100% 4.050 2.025 Y Rpl12 n/a
9 TRCN0000412346 AGATCAAAGTCGTATACCTGA pLKO_005 115 CDS 100% 2.640 1.320 Y RPL12 n/a
10 TRCN0000117443 GTGATGACATTGCCAAGGCAA pLKO.1 217 CDS 100% 2.640 1.320 Y RPL12 n/a
11 TRCN0000117736 GTGACTGGAAGGGCCTGAGTA pLKO.1 241 CDS 100% 1.650 0.825 Y CLIC1P1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000976.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11105 pDONR223 100% 80% 80% None 111_209del n/a
2 ccsbBroad304_11105 pLX_304 0% 80% 80% V5 111_209del n/a
Download CSV