Transcript: Human NM_000986.4

Homo sapiens ribosomal protein L24 (RPL24), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
RPL24 (6152)
Length:
560
CDS:
43..516

Additional Resources:

NCBI RefSeq record:
NM_000986.4
NBCI Gene record:
RPL24 (6152)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000986.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000117645 CCTCTACAGAAGGAAGCACAA pLKO.1 201 CDS 100% 4.050 2.430 N RPL24 n/a
2 TRCN0000300641 CCTCTACAGAAGGAAGCACAA pLKO_005 201 CDS 100% 4.050 2.430 N RPL24 n/a
3 TRCN0000117642 CCTGAAGTTAGAAAGGCTCAA pLKO.1 334 CDS 100% 4.050 2.430 N RPL24 n/a
4 TRCN0000331251 CCTGAAGTTAGAAAGGCTCAA pLKO_005 334 CDS 100% 4.050 2.430 N RPL24 n/a
5 TRCN0000117646 GCTTTCCTTTCCAAGAGGAAT pLKO.1 157 CDS 100% 0.495 0.297 N RPL24 n/a
6 TRCN0000300703 GCTTTCCTTTCCAAGAGGAAT pLKO_005 157 CDS 100% 0.495 0.297 N RPL24 n/a
7 TRCN0000117643 GTGCATCTCTTGCTGATATAA pLKO.1 293 CDS 100% 15.000 7.500 Y RPL24 n/a
8 TRCN0000300643 GTGCATCTCTTGCTGATATAA pLKO_005 293 CDS 100% 15.000 7.500 Y RPL24 n/a
9 TRCN0000104248 TGGTGCATCTCTTGCTGATAT pLKO.1 291 CDS 100% 13.200 6.600 Y Rpl24 n/a
10 TRCN0000117644 ACAAGCTATCAGGGCTGCTAA pLKO.1 360 CDS 100% 4.950 2.475 Y RPL24 n/a
11 TRCN0000300642 ACAAGCTATCAGGGCTGCTAA pLKO_005 360 CDS 100% 4.950 2.475 Y RPL24 n/a
12 TRCN0000104247 CTGGTGCATCTCTTGCTGATA pLKO.1 290 CDS 100% 4.950 2.475 Y Rpl24 n/a
13 TRCN0000104246 GCCAGGACCGACGGGAAGGTT pLKO.1 106 CDS 100% 0.000 0.000 Y Rpl24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000986.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01427 pDONR223 98.7% 100% 100% None n/a
2 ccsbBroad304_01427 pLX_304 0% 100% 100% V5 (not translated due to prior stop codon) n/a
3 TRCN0000480508 AGCGTTACTCTGTCGTTGAGCCAT pLX_317 73.1% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV