Transcript: Mouse NM_001001187.3

Mus musculus zinc finger protein 738 (Zfp738), mRNA.

Source:
NCBI, updated 2017-05-07
Taxon:
Mus musculus (mouse)
Gene:
Zfp738 (408068)
Length:
4523
CDS:
75..2456

Additional Resources:

NCBI RefSeq record:
NM_001001187.3
NBCI Gene record:
Zfp738 (408068)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001001187.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085223 GTATATAACAAGGCCTTCATT pLKO.1 2373 CDS 100% 5.625 4.500 N Zfp738 n/a
2 TRCN0000085224 GCGTTCCATGTTCCATCCAAA pLKO.1 2217 CDS 100% 4.950 3.465 N Zfp738 n/a
3 TRCN0000096047 GCCTGCTCAGTTGGATCTGTA pLKO.1 173 CDS 100% 4.950 2.970 N Zfp738 n/a
4 TRCN0000085225 GCCTTCTGCATTCCATTATTA pLKO.1 537 CDS 100% 15.000 7.500 Y Zfp738 n/a
5 TRCN0000239639 CAGGAGAGAAACCCTACAAAT pLKO_005 1675 CDS 100% 13.200 6.600 Y Zfp992 n/a
6 TRCN0000085226 CCCTATAACAGTCAAGTATAT pLKO.1 2358 CDS 100% 13.200 6.600 Y Zfp738 n/a
7 TRCN0000085307 GCCTTCCACTTTCCATCATTA pLKO.1 705 CDS 100% 13.200 6.600 Y Zfp65 n/a
8 TRCN0000095232 GCCTTCCATTATCCATCAATA pLKO.1 789 CDS 100% 13.200 6.600 Y Zfp729a n/a
9 TRCN0000096046 CAAATACAAGAGCCTTCAGAT pLKO.1 279 CDS 100% 4.950 2.475 Y Zfp738 n/a
10 TRCN0000016346 CACTGGAGAGAAACCCTACAA pLKO.1 2848 3UTR 100% 4.950 2.475 Y ZNF254 n/a
11 TRCN0000096045 CTAAGCCATATCTGGTCACAT pLKO.1 250 CDS 100% 4.950 2.475 Y Zfp738 n/a
12 TRCN0000085227 GTCATCACTTTCTAAACACAA pLKO.1 2147 CDS 100% 4.950 2.475 Y Zfp738 n/a
13 TRCN0000095789 CCATCAAGACTTTCCAACCAT pLKO.1 969 CDS 100% 3.000 1.500 Y Zfp458 n/a
14 TRCN0000096044 CTGGAGAATTACAGCAACCTT pLKO.1 207 CDS 100% 3.000 1.500 Y Zfp738 n/a
15 TRCN0000096048 TGGAGCAAATACAAGAGCCTT pLKO.1 274 CDS 100% 2.640 1.320 Y Zfp738 n/a
16 TRCN0000021905 GACGTGATGCTGGAGAATTAT pLKO.1 198 CDS 100% 15.000 7.500 Y ZNF765 n/a
17 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 2850 3UTR 100% 13.200 6.600 Y Zfp934 n/a
18 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 2850 3UTR 100% 13.200 6.600 Y 2810408B13Rik n/a
19 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 2850 3UTR 100% 13.200 6.600 Y EG668616 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001001187.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.