Transcript: Human NM_001001330.3

Homo sapiens receptor accessory protein 3 (REEP3), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
REEP3 (221035)
Length:
5172
CDS:
146..913

Additional Resources:

NCBI RefSeq record:
NM_001001330.3
NBCI Gene record:
REEP3 (221035)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001001330.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134552 GAAGGAATATGTTCGATGGAT pLKO.1 241 CDS 100% 3.000 4.200 N REEP3 n/a
2 TRCN0000137535 CGGCAAGGTTTAAACCTTGCA pLKO.1 512 CDS 100% 0.264 0.370 N REEP3 n/a
3 TRCN0000137150 GTGATTGAAACAGTAGCCGAT pLKO.1 293 CDS 100% 2.160 1.728 N REEP3 n/a
4 TRCN0000190885 CCTGTACTATGAGCTGAAGAT pLKO.1 334 CDS 100% 4.950 3.465 N Reep3 n/a
5 TRCN0000138455 CCATACCAACCTCTACCAGAA pLKO.1 650 CDS 100% 4.050 2.835 N REEP3 n/a
6 TRCN0000137972 GCTTCGAAGATCGCAAAGCAT pLKO.1 802 CDS 100% 3.000 2.100 N REEP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001001330.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05248 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05248 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472512 GATCCGGGCCGTATGCATCGACCG pLX_317 52.6% 100% 100% V5 n/a
Download CSV