Construct: ORF TRCN0000472512
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013528.1_s317c1
- Derived from:
- ccsbBroadEn_05248
- DNA Barcode:
- GATCCGGGCCGTATGCATCGACCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- REEP3 (221035)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472512
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 221035 | REEP3 | receptor accessory protein 3 | NM_001001330.3 | 100% | 100% | |
| 2 | human | 221035 | REEP3 | receptor accessory protein 3 | XM_011539501.2 | 57.5% | 53.6% | (many diffs) |
| 3 | human | 221035 | REEP3 | receptor accessory protein 3 | XM_017015896.1 | 57.5% | 53.6% | (many diffs) |
| 4 | mouse | 28193 | Reep3 | receptor accessory protein 3 | NM_178606.5 | 84.1% | 92.1% | (many diffs) |
| 5 | mouse | 28193 | Reep3 | receptor accessory protein 3 | XM_006513726.3 | 78.4% | 86.2% | (many diffs) |
| 6 | mouse | 28193 | Reep3 | receptor accessory protein 3 | NM_001204915.1 | 76% | 79.3% | (many diffs) |
| 7 | mouse | 28193 | Reep3 | receptor accessory protein 3 | XM_006513728.2 | 49.7% | 54.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 831
- ORF length:
- 765
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt gtcctggatg atctccagag ccgtggtgct ggtgtttgga atgctttatc 121 ctgcatatta ttcatacaaa gctgtgaaaa caaaaaacgt gaaggaatat gttcgatgga 181 tgatgtactg gattgttttt gctctctata ctgtgattga aacagtagcc gatcaaacag 241 ttgcttggtt tcccctgtac tatgagctga agattgcttt tgtcatatgg ctgctttctc 301 cctataccaa aggagcaagt ttaatatata gaaaattcct tcatccactt ctttcttcaa 361 aggaaaggga gattgatgat tatattgtac aagcaaagga acgaggctat gaaaccatgg 421 taaactttGG ACGGCAAGGT TTAAACCTTG CAGCTACTGC TGCTGTTACT GCAGCAGTAA 481 AGAGCCAAGG AGCAATAACT GAACGTTTAA GAAGCTTCAG TATGCATGAT TTAACAACTA 541 TCCAAGGTGA TGAGCCTGTG GGACAAAGAC CATACCAACC TCTACCAGAA GCAAAAAAGA 601 AAAGTAAACC AGCCCCCAGT GAATCAGCAG GTTATGGAAT TCCACTGAAA GACGGAGATG 661 AGAAAACAGA TGAAGAAGCA GAGGGGCCAT ATTCAGATAA TGAGATGTTA ACACACAAAG 721 GGCTTCGAAG ATCGCAAAGC ATGAAATCTG TGAAAACCAC CAAAGGCCGC AAAGAGGTGC 781 GGTACGGGTC ACTAAAATAC AAAGTGAAGA AACGACCACA AGTGTATTTT TACCCAACTT 841 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 901 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 961 CTTGTGGAAA GGACGAGATC CGGGCCGTAT GCATCGACCG ACGCGTTAAG TCgacaatca 1021 acctctggat tacaaaattt gtgaaagatt