Transcript: Mouse NM_001001565.2

Mus musculus chondroitin polymerizing factor (Chpf), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Chpf (74241)
Length:
3250
CDS:
996..2834

Additional Resources:

NCBI RefSeq record:
NM_001001565.2
NBCI Gene record:
Chpf (74241)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001001565.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127003 TGCTTCTACAACTCCGACTAT pLKO.1 2538 CDS 100% 4.950 6.930 N Chpf n/a
2 TRCN0000127001 CGAGGGAATGCACTACAACTA pLKO.1 1394 CDS 100% 4.950 3.960 N Chpf n/a
3 TRCN0000127000 CCTGGATGTGTACGAGTTGTT pLKO.1 2618 CDS 100% 4.950 3.465 N Chpf n/a
4 TRCN0000126999 TGGTCCCTTGTCTCTTGCTTT pLKO.1 2934 3UTR 100% 4.950 3.465 N Chpf n/a
5 TRCN0000127002 GCTTCAGCAACCCATCTCTAT pLKO.1 1164 CDS 100% 4.950 2.970 N Chpf n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001001565.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08934 pDONR223 100% 68.4% 74.8% None (many diffs) n/a
2 ccsbBroad304_08934 pLX_304 0% 68.4% 74.8% V5 (many diffs) n/a
3 TRCN0000477018 AGATCCGCAGCTCATCGGATAACA pLX_317 9.4% 68.4% 74.8% V5 (many diffs) n/a
Download CSV