Transcript: Human NM_001001710.3

Homo sapiens family with sequence similarity 166 member A (FAM166A), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
FAM166A (401565)
Length:
1091
CDS:
37..990

Additional Resources:

NCBI RefSeq record:
NM_001001710.3
NBCI Gene record:
FAM166A (401565)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001001710.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142981 CAAAGCGAAACCACACACTAT pLKO.1 968 CDS 100% 4.950 6.930 N FAM166A n/a
2 TRCN0000121721 CATGTCCAAACCCAAGTTCAT pLKO.1 210 CDS 100% 4.950 6.930 N FAM166A n/a
3 TRCN0000142090 GCAAAGCGAAACCACACACTA pLKO.1 967 CDS 100% 4.950 6.930 N FAM166A n/a
4 TRCN0000143230 GAGCCAGTTCCTGTTTAGAAA pLKO.1 777 CDS 100% 5.625 3.938 N FAM166A n/a
5 TRCN0000142072 CCATGTCCAAACCCAAGTTCA pLKO.1 209 CDS 100% 4.950 3.465 N FAM166A n/a
6 TRCN0000143569 GAAGCCCTCTAAGAACTTTGA pLKO.1 312 CDS 100% 4.950 3.465 N FAM166A n/a
7 TRCN0000142031 GACAAGAGCCAGTTCCTGTTT pLKO.1 772 CDS 100% 4.950 3.465 N FAM166A n/a
8 TRCN0000141555 CCCAAGTTCATTGAGGACTTC pLKO.1 220 CDS 100% 4.050 2.835 N FAM166A n/a
9 TRCN0000142073 CCCTAACCTAATCCAACGCAA pLKO.1 657 CDS 100% 2.640 1.848 N FAM166A n/a
10 TRCN0000141789 GAACTTTGAGATTCTGGGCCA pLKO.1 324 CDS 100% 0.540 0.378 N FAM166A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001001710.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05650 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05650 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466702 TCCCTAACAGCGACTTTGAGTTTG pLX_317 44.5% 100% 100% V5 n/a
Download CSV