Transcript: Human NM_001001975.2

Homo sapiens ATP synthase F1 subunit delta (ATP5F1D), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
ATP5F1D (513)
Length:
699
CDS:
101..607

Additional Resources:

NCBI RefSeq record:
NM_001001975.2
NBCI Gene record:
ATP5F1D (513)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001001975.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043466 CAGCGGTTCCATCGCAGTGAA pLKO.1 400 CDS 100% 1.650 2.310 N ATP5F1D n/a
2 TRCN0000291021 CAGCGGTTCCATCGCAGTGAA pLKO_005 400 CDS 100% 1.650 2.310 N ATP5F1D n/a
3 TRCN0000043465 CGCCGACTCTTCGGTGCAGTT pLKO.1 421 CDS 100% 0.000 0.000 N ATP5F1D n/a
4 TRCN0000290950 CGCCGACTCTTCGGTGCAGTT pLKO_005 421 CDS 100% 0.000 0.000 N ATP5F1D n/a
5 TRCN0000043464 CAACCAGATGTCCTTCACCTT pLKO.1 205 CDS 100% 2.640 1.848 N ATP5F1D n/a
6 TRCN0000043463 CCTCCAAATACTTTGTGAGCA pLKO.1 381 CDS 100% 2.640 1.848 N ATP5F1D n/a
7 TRCN0000307254 CCTCCAAATACTTTGTGAGCA pLKO_005 381 CDS 100% 2.640 1.848 N ATP5F1D n/a
8 TRCN0000043467 CGGGCAGAGATCCAGATCCGA pLKO.1 548 CDS 100% 0.000 0.000 N ATP5F1D n/a
9 TRCN0000290951 CGGGCAGAGATCCAGATCCGA pLKO_005 548 CDS 100% 0.000 0.000 N ATP5F1D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001001975.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00129 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00129 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468392 AAACCCAGGTCCTGTAAATTTACC pLX_317 60.4% 100% 100% V5 n/a
Download CSV