Transcript: Mouse NM_001001979.2

Mus musculus multiple EGF-like-domains 10 (Megf10), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Megf10 (70417)
Length:
7514
CDS:
659..4102

Additional Resources:

NCBI RefSeq record:
NM_001001979.2
NBCI Gene record:
Megf10 (70417)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001001979.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119450 CGTTTGTACTTGCACCAACAA pLKO.1 2671 CDS 100% 4.950 6.930 N Megf10 n/a
2 TRCN0000119449 GCTACGGGATAAATTGTTCTT pLKO.1 1998 CDS 100% 4.950 6.930 N Megf10 n/a
3 TRCN0000119448 GCAGACTATACCATCGCAGAA pLKO.1 3368 CDS 100% 4.050 2.835 N Megf10 n/a
4 TRCN0000119451 CAAAGAACAGTCACATCCCTT pLKO.1 3963 CDS 100% 2.640 1.848 N Megf10 n/a
5 TRCN0000119447 CGGAATTATGATGTGTCCATT pLKO.1 5191 3UTR 100% 4.950 2.970 N Megf10 n/a
6 TRCN0000436749 GCTATGGCTGTCGCCAGATAT pLKO_005 3042 CDS 100% 13.200 9.240 N MEGF10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001001979.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09193 pDONR223 100% 87.1% 94% None (many diffs) n/a
2 ccsbBroad304_09193 pLX_304 0% 87.1% 94% V5 (many diffs) n/a
3 TRCN0000479271 TGAACTTAGAGCTCTTCGATGGTC pLX_317 10.5% 87.1% 94% V5 (many diffs) n/a
Download CSV