Transcript: Human NM_001002926.2

Homo sapiens TWIST neighbor (TWISTNB), mRNA.

Source:
NCBI, updated 2019-09-12
Taxon:
Homo sapiens (human)
Gene:
TWISTNB (221830)
Length:
3893
CDS:
22..1038

Additional Resources:

NCBI RefSeq record:
NM_001002926.2
NBCI Gene record:
TWISTNB (221830)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001002926.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017409 TGCCTAGAGTTGCCGACTTAT pLKO.1 103 CDS 100% 13.200 18.480 N LOC402464 n/a
2 TRCN0000015208 GCTGTTTAGTACATGGGTGTT pLKO.1 452 CDS 100% 4.050 5.670 N TWISTNB n/a
3 TRCN0000015212 CCCTATTGCATATGATAACAT pLKO.1 288 CDS 100% 0.000 0.000 N TWISTNB n/a
4 TRCN0000017410 GCCCTGCAGAATACTAATAAT pLKO.1 799 CDS 100% 15.000 12.000 N LOC402464 n/a
5 TRCN0000015209 CGCTCTGAAGTTTCTGAAGAA pLKO.1 640 CDS 100% 4.950 3.960 N TWISTNB n/a
6 TRCN0000017411 CATCTTAACATTGAAGCCGAT pLKO.1 358 CDS 100% 2.160 1.728 N LOC402464 n/a
7 TRCN0000017408 GAGATAAACATGGGTGATGAA pLKO.1 529 CDS 100% 4.950 3.465 N LOC402464 n/a
8 TRCN0000015211 GCTGCTGGAGTATTCTGCATT pLKO.1 583 CDS 100% 4.950 3.465 N TWISTNB n/a
9 TRCN0000017412 GCAGATGACACTCCAATGGAA pLKO.1 772 CDS 100% 3.000 2.100 N LOC402464 n/a
10 TRCN0000015210 GCAGAATACTAATAATGCGAA pLKO.1 804 CDS 100% 2.640 1.848 N TWISTNB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001002926.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05266 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05266 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467124 GGCTTCTCACGATCCGCATATTCC pLX_317 40.3% 100% 100% V5 n/a
4 ccsbBroadEn_13430 pDONR223 100% 66.6% 66.5% None 669_670insA;678_1014del n/a
5 ccsbBroad304_13430 pLX_304 0% 66.6% 66.5% V5 669_670insA;678_1014del n/a
6 TRCN0000477276 CCGCTTTACCCGCGTGCGTCAAGA pLX_317 54.6% 66.6% 66.5% V5 669_670insA;678_1014del n/a
Download CSV