Transcript: Human NM_001003811.2

Homo sapiens testis expressed 11 (TEX11), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-29
Taxon:
Homo sapiens (human)
Gene:
TEX11 (56159)
Length:
3134
CDS:
157..2979

Additional Resources:

NCBI RefSeq record:
NM_001003811.2
NBCI Gene record:
TEX11 (56159)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001003811.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424841 ATGATAATTCACCTAACATAC pLKO_005 263 CDS 100% 10.800 8.640 N TEX11 n/a
2 TRCN0000420848 GCTTAGCCAAAGCTATGATAT pLKO_005 888 CDS 100% 13.200 9.240 N TEX11 n/a
3 TRCN0000130690 CCTGAATAGAGCCTTTGTGAA pLKO.1 1983 CDS 100% 4.950 3.465 N TEX11 n/a
4 TRCN0000130860 GCACTAAAGACTACCCAGAAA pLKO.1 2717 CDS 100% 4.950 3.465 N TEX11 n/a
5 TRCN0000129496 GCCCTTAGACTTCTGTCTGAA pLKO.1 1155 CDS 100% 4.950 3.465 N TEX11 n/a
6 TRCN0000128041 GCATCTATGTGTGTACTGCAA pLKO.1 754 CDS 100% 2.640 1.848 N TEX11 n/a
7 TRCN0000129789 CAGCAAATGTATGCACAACTT pLKO.1 2598 CDS 100% 4.950 2.970 N TEX11 n/a
8 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 220 CDS 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001003811.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10462 pDONR223 100% 97.2% 97% None (many diffs) n/a
2 ccsbBroad304_10462 pLX_304 0% 97.2% 97% V5 (many diffs) n/a
3 TRCN0000479091 ATTCGAGCACTAGAGGGGTGCACT pLX_317 12.4% 97.2% 97% V5 (many diffs) n/a
Download CSV