Transcript: Mouse NM_001003908.1

Mus musculus clathrin, heavy polypeptide (Hc) (Cltc), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Cltc (67300)
Length:
6178
CDS:
204..5231

Additional Resources:

NCBI RefSeq record:
NM_001003908.1
NBCI Gene record:
Cltc (67300)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001003908.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000113160 GCCGACAAAGACAACACTAAT pLKO.1 5688 3UTR 100% 13.200 18.480 N Cltc n/a
2 TRCN0000309523 GCCGACAAAGACAACACTAAT pLKO_005 5688 3UTR 100% 13.200 18.480 N Cltc n/a
3 TRCN0000113161 GCGAACATCAATAGATGCTTA pLKO.1 4643 CDS 100% 4.950 6.930 N Cltc n/a
4 TRCN0000331948 GCGAACATCAATAGATGCTTA pLKO_005 4643 CDS 100% 4.950 6.930 N Cltc n/a
5 TRCN0000011216 CGGTTGCTCTTGTTACGGATA pLKO.1 556 CDS 100% 4.050 5.670 N CLTC n/a
6 TRCN0000342755 CGGTTGCTCTTGTTACGGATA pLKO_005 556 CDS 100% 4.050 5.670 N CLTC n/a
7 TRCN0000379759 ACACGTGTTATGGAGTATATT pLKO_005 3315 CDS 100% 15.000 10.500 N Cltc n/a
8 TRCN0000380642 ACACTCGTGCAGTCAATTATT pLKO_005 4498 CDS 100% 15.000 10.500 N CLTC n/a
9 TRCN0000379998 GATTACCAAGTATGGTTATAT pLKO_005 1028 CDS 100% 15.000 10.500 N Cltc n/a
10 TRCN0000113162 GCTCCAGATATTGCCAACATT pLKO.1 3357 CDS 100% 5.625 3.938 N Cltc n/a
11 TRCN0000309449 GCTCCAGATATTGCCAACATT pLKO_005 3357 CDS 100% 5.625 3.938 N Cltc n/a
12 TRCN0000113164 CTGAACAAATACGAGTCCTTA pLKO.1 1482 CDS 100% 4.950 3.465 N Cltc n/a
13 TRCN0000113163 CCAGAGAGATTTCTTCGTGAA pLKO.1 2871 CDS 100% 4.050 2.835 N Cltc n/a
14 TRCN0000309447 CCAGAGAGATTTCTTCGTGAA pLKO_005 2871 CDS 100% 4.050 2.835 N Cltc n/a
15 TRCN0000007981 CGTGTTCTTGTAACCTTTATT pLKO.1 5317 3UTR 100% 15.000 10.500 N CLTC n/a
16 TRCN0000342693 CGTGTTCTTGTAACCTTTATT pLKO_005 5317 3UTR 100% 15.000 10.500 N CLTC n/a
17 TRCN0000007983 CCTGTGTAGATGGGAAAGAAT pLKO.1 3979 CDS 100% 5.625 3.938 N CLTC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001003908.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.