Transcript: Mouse NM_001003934.2

Mus musculus reticulon 3 (Rtn3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Rtn3 (20168)
Length:
5038
CDS:
209..3103

Additional Resources:

NCBI RefSeq record:
NM_001003934.2
NBCI Gene record:
Rtn3 (20168)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001003934.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000314218 CAATTGTCTATGAGAAGTATA pLKO_005 2976 CDS 100% 13.200 18.480 N Rtn3 n/a
2 TRCN0000119405 CGGGATCAGACCAAGTCAATT pLKO.1 3029 CDS 100% 13.200 18.480 N Rtn3 n/a
3 TRCN0000349476 CGGGATCAGACCAAGTCAATT pLKO_005 3029 CDS 100% 13.200 18.480 N Rtn3 n/a
4 TRCN0000119404 CGTGTGCGGATTCCTTTGTTT pLKO.1 345 CDS 100% 5.625 7.875 N Rtn3 n/a
5 TRCN0000314216 ACAAGGCCCTCAAACTCATTA pLKO_005 2820 CDS 100% 13.200 9.240 N Rtn3 n/a
6 TRCN0000314158 CCTACTTGGATGTGGACATTA pLKO_005 2745 CDS 100% 13.200 9.240 N Rtn3 n/a
7 TRCN0000314215 GAGCTTTACATGTACCATAAA pLKO_005 3375 3UTR 100% 13.200 9.240 N Rtn3 n/a
8 TRCN0000119402 CCAGCCATTGAGTTATTGTAA pLKO.1 3978 3UTR 100% 5.625 3.938 N Rtn3 n/a
9 TRCN0000119403 GCTTTCCACAACTACATGAAT pLKO.1 2780 CDS 100% 5.625 3.938 N Rtn3 n/a
10 TRCN0000119406 ACATCCATTCAAGGCCTACTT pLKO.1 2731 CDS 100% 4.950 3.465 N Rtn3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001003934.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02397 pDONR223 100% 20.3% 20.8% None (many diffs) n/a
2 ccsbBroad304_02397 pLX_304 0% 20.3% 20.8% V5 (many diffs) n/a
Download CSV