Transcript: Human NM_001004128.2

Homo sapiens quiescin sulfhydryl oxidase 1 (QSOX1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-07-06
Taxon:
Homo sapiens (human)
Gene:
QSOX1 (5768)
Length:
2583
CDS:
76..1890

Additional Resources:

NCBI RefSeq record:
NM_001004128.2
NBCI Gene record:
QSOX1 (5768)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001004128.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064183 CCGGACAATGAAGAAGCCTTT pLKO.1 2043 3UTR 100% 4.050 5.670 N QSOX1 n/a
2 TRCN0000064187 TCTAGCCACAACAGGGTCAAT pLKO.1 1510 CDS 100% 4.950 3.960 N QSOX1 n/a
3 TRCN0000064186 GATGGATTCTTTGCGAGAAAT pLKO.1 604 CDS 100% 13.200 9.240 N QSOX1 n/a
4 TRCN0000064185 GCCAATGTGGTGAGAAAGTTT pLKO.1 742 CDS 100% 5.625 3.938 N QSOX1 n/a
5 TRCN0000064184 GCCAAGAAGGTGAACTGGATT pLKO.1 1228 CDS 100% 4.950 3.465 N QSOX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001004128.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06813 pDONR223 100% 99.7% 99.8% None (many diffs) n/a
2 ccsbBroad304_06813 pLX_304 0% 99.7% 99.8% V5 (many diffs) n/a
3 TRCN0000466385 CTTCCCTGGATGTTGGCCAAGCCC pLX_317 21.9% 99.7% 99.8% V5 (many diffs) n/a
Download CSV