Transcript: Human NM_001004308.2

Homo sapiens retrotransposon Gag like 4 (RTL4), mRNA.

Source:
NCBI, updated 2019-09-23
Taxon:
Homo sapiens (human)
Gene:
RTL4 (340595)
Length:
2958
CDS:
442..1374

Additional Resources:

NCBI RefSeq record:
NM_001004308.2
NBCI Gene record:
RTL4 (340595)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001004308.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122079 CCAAATCTCTAATCCTGCAAA pLKO.1 696 CDS 100% 4.950 3.960 N RTL4 n/a
2 TRCN0000145045 CCTTCCATAGAGCTATATGTT pLKO.1 1964 3UTR 100% 5.625 3.938 N RTL4 n/a
3 TRCN0000139213 CACTCAGGTGACTACCTACTT pLKO.1 666 CDS 100% 4.950 3.465 N RTL4 n/a
4 TRCN0000139109 CACAAGAGATTGCCTTGCCAA pLKO.1 1308 CDS 100% 2.640 1.848 N RTL4 n/a
5 TRCN0000140869 GCTTCCTTGATCCAACACCAA pLKO.1 1147 CDS 100% 2.640 1.848 N RTL4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001004308.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000478067 CAATTATTCAGCTGGAAGCCAATC pLX_317 20.4% 99.6% 99.6% V5 80T>C;249A>C;657T>C n/a
2 ccsbBroadEn_10029 pDONR223 100% 99.5% 99.3% None (many diffs) n/a
3 ccsbBroad304_10029 pLX_304 0% 99.5% 99.3% V5 (many diffs) n/a
Download CSV