Transcript: Human NM_001004318.3

Homo sapiens acid phosphatase 7, tartrate resistant (putative) (ACP7), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
ACP7 (390928)
Length:
2903
CDS:
212..1528

Additional Resources:

NCBI RefSeq record:
NM_001004318.3
NBCI Gene record:
ACP7 (390928)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001004318.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359840 TTCTCCACCGAGGTCTATTTC pLKO_005 935 CDS 100% 13.200 18.480 N ACP7 n/a
2 TRCN0000359908 ATAGGTTCATGCGGCTCATTG pLKO_005 762 CDS 100% 10.800 15.120 N ACP7 n/a
3 TRCN0000051301 GATAGGTTCATGCGGCTCATT pLKO.1 761 CDS 100% 4.950 6.930 N ACP7 n/a
4 TRCN0000051302 GTTACTGTCTACTCCTGCTAT pLKO.1 240 CDS 100% 4.950 6.930 N ACP7 n/a
5 TRCN0000051300 CGACCTCCAGAAAGCCAATAA pLKO.1 1009 CDS 100% 13.200 9.240 N ACP7 n/a
6 TRCN0000359838 GAACGACTGTGGCCAATTTAC pLKO_005 1223 CDS 100% 13.200 9.240 N ACP7 n/a
7 TRCN0000359839 GACCTCCAGAAAGCCAATAAG pLKO_005 1010 CDS 100% 13.200 9.240 N ACP7 n/a
8 TRCN0000051299 CCAATTTACAACTACCAGGTA pLKO.1 1235 CDS 100% 2.640 1.848 N ACP7 n/a
9 TRCN0000051298 GCTTCAGGAATGAAGAGGCTT pLKO.1 1828 3UTR 100% 0.264 0.185 N ACP7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001004318.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10109 pDONR223 100% 99.9% 100% None 594G>A n/a
2 ccsbBroad304_10109 pLX_304 0% 99.9% 100% V5 594G>A n/a
3 TRCN0000480326 TTCTGTCTCCTGTTCGATCCATGC pLX_317 27.5% 99.9% 100% V5 594G>A n/a
Download CSV