Construct: ORF TRCN0000480326
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009339.1_s317c1
- Derived from:
- ccsbBroadEn_10109
- DNA Barcode:
- TTCTGTCTCCTGTTCGATCCATGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ACP7 (390928)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480326
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 390928 | ACP7 | acid phosphatase 7, tartrat... | NM_001004318.3 | 99.9% | 100% | 594G>A |
| 2 | human | 390928 | ACP7 | acid phosphatase 7, tartrat... | XM_011526966.3 | 99.9% | 100% | 594G>A |
| 3 | human | 390928 | ACP7 | acid phosphatase 7, tartrat... | XM_017026807.2 | 99.9% | 100% | 594G>A |
| 4 | human | 390928 | ACP7 | acid phosphatase 7, tartrat... | XM_011526967.3 | 89.4% | 89.4% | 594G>A;1113_1114ins138 |
| 5 | human | 390928 | ACP7 | acid phosphatase 7, tartrat... | XM_011526969.2 | 85% | 57.8% | (many diffs) |
| 6 | human | 390928 | ACP7 | acid phosphatase 7, tartrat... | NM_001363687.2 | 75.9% | 42.5% | (many diffs) |
| 7 | human | 390928 | ACP7 | acid phosphatase 7, tartrat... | XM_017026808.2 | 49.7% | 49.7% | 0_1ins660 |
| 8 | human | 390928 | ACP7 | acid phosphatase 7, tartrat... | XR_001753684.2 | 45.2% | (many diffs) | |
| 9 | mouse | 101744 | Acp7 | acid phosphatase 7, tartrat... | XM_006539450.1 | 82% | 85.8% | (many diffs) |
| 10 | mouse | 101744 | Acp7 | acid phosphatase 7, tartrat... | NM_175319.4 | 72.5% | 75.8% | (many diffs) |
| 11 | mouse | 101744 | Acp7 | acid phosphatase 7, tartrat... | XM_006539447.3 | 72.5% | 75.8% | (many diffs) |
| 12 | mouse | 101744 | Acp7 | acid phosphatase 7, tartrat... | XM_006539449.3 | 72.5% | 75.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1383
- ORF length:
- 1314
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gcaccccctt cctggctact ggtcctgtta ctgtctactc ctgctattct 121 ccttgggagt ccaggggtcc ctgggggctc ccagcgctgc cccagagcaa gtccatctgt 181 cttacccagg tgagccaggc tccatgactg taacttggac cacatgggtc ccaacccgct 241 ctgaagtgca attcgggttg cagccgtcgg ggcccctgcc cctccgcgcc cagggcacct 301 tcgtcccctt tgtggacggg ggcattctcc ggcggaagct ctacatacac cgagtcacgc 361 ttcgcaagct gctgccaggg gttcagtatg tttatcgctg tggcagtgcg cagggctgga 421 gccgtcggtt ccgcttcagg gccctcaaga atggggccca ctggagtccc cgtctggctg 481 tgtttggaga cctgggggct gacaacccga aggccgtccc ccggctgcgc agggacaccc 541 agcagggcat gtatgacgcc gttctccatg tgggagactt tgcctacaac ctggatcagg 601 acaacgcccg tgttggggat aggttcatgc ggctcattga acccgtggct gccagcctgc 661 catacatgac atgccctggg aatcatgaag aacgctacaa cttctctaac tacaaggctc 721 gcttcagcat gccgggggat aatgagggcc tgtggtacag ctgggatctg ggtcccgccc 781 acatcatctc cttctccacc gaggtctatt tctttctcca ttatggccgc cacttggtac 841 agaggcagtt tcgctggctg gagagcgacc tccagaaagc caataagaac cgggcagccc 901 ggccgtggat catcactatg gggcaccggc ccatgtactg ctccaacgca gatctggacg 961 actgcacacg acatgaaagc aaggtccgca aaggcctcca aggcaagctg tacgggttgg 1021 aggaTCTTTT CTACAAATAT GGAGTGGATC TGCAGCTGTG GGCTCATGAG CACTCGTATG 1081 AACGACTGTG GCCAATTTAC AACTACCAGG TATTTAACGG CAGCCGAGAG ATGCCCTACA 1141 CCAACCCGCG AGGGCCTGTC CACATCATCA CAGGATCTGC TGGCTGTGAG GAGCGGCTGA 1201 CGCCCTTTGC TGTCTTCCCG AGGCCCTGGA GTGCCGTGCG TGTGAAGGAG TACGGGTATA 1261 CGCGGCTGCA CATCCTCAAC GGGACCCACA TCCACATCCA GCAGGTGTCG GACGACCAGG 1321 ATGGGAAGAT CGTAGATGAT GTCTGGGTGG TGAGACCCCT GTTTGGCCGG AGGATGTACC 1381 TCTTGCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1441 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1501 GGCTTTATAT ATCTTGTGGA AAGGACGATT CTGTCTCCTG TTCGATCCAT GCACGCGTTA 1561 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt