Transcript: Human NM_001004705.1

Homo sapiens olfactory receptor family 4 subfamily D member 10 (OR4D10), mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
OR4D10 (390197)
Length:
936
CDS:
1..936

Additional Resources:

NCBI RefSeq record:
NM_001004705.1
NBCI Gene record:
OR4D10 (390197)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001004705.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000061004 GTGTCCTACATAGTCATATTA pLKO.1 646 CDS 100% 15.000 21.000 N OR4D10 n/a
2 TRCN0000061005 GATGTTTCTATTCCACCTTAT pLKO.1 300 CDS 100% 10.800 15.120 N OR4D10 n/a
3 TRCN0000061007 TGTGACAACTTTGCTGGGAAA pLKO.1 105 CDS 100% 4.050 5.670 N OR4D10 n/a
4 TRCN0000061006 CCATAATTTATCTATTGCCGA pLKO.1 189 CDS 100% 0.660 0.924 N OR4D10 n/a
5 TRCN0000061003 CGGGAAGTGAGCTTAGTCTTA pLKO.1 61 CDS 100% 4.950 3.465 N OR4D10 n/a
6 TRCN0000204807 GTGCCCTGCATCTATGTCTAT pLKO.1 754 CDS 100% 4.950 2.475 Y Olfr1425 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001004705.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05611 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05611 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477915 AATTGTGAGTTCGGCTCTCGCGTA pLX_317 36.8% 100% 100% V5 n/a
Download CSV