Transcript: Human NM_001004722.3

Homo sapiens NCK adaptor protein 2 (NCK2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
NCK2 (8440)
Length:
1795
CDS:
277..528

Additional Resources:

NCBI RefSeq record:
NM_001004722.3
NBCI Gene record:
NCK2 (8440)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001004722.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425562 ACTTCTCCGTGTCCCTTAAAG pLKO_005 510 CDS 100% 13.200 18.480 N NCK2 n/a
2 TRCN0000434745 ATACGTTTGCTGATAGCAATA pLKO_005 1171 3UTR 100% 10.800 15.120 N NCK2 n/a
3 TRCN0000122918 CGGGCTATGTACCGTCCAACT pLKO.1 419 CDS 100% 1.350 1.890 N NCK2 n/a
4 TRCN0000122914 GCTTGTTTGAATCTCACAATT pLKO.1 1376 3UTR 100% 13.200 9.240 N NCK2 n/a
5 TRCN0000122915 CGTGGACAATGTCTACTGCAT pLKO.1 565 3UTR 100% 2.640 1.848 N NCK2 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 1521 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001004722.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01928 pDONR223 100% 21.1% 20% None (many diffs) n/a
2 ccsbBroad304_01928 pLX_304 0% 21.1% 20% V5 (many diffs) n/a
3 TRCN0000466009 CCAACGCTTTGACCTTTGCAGGAG pLX_317 28.3% 21.1% 20% V5 (many diffs) n/a
Download CSV